Prev. |  KEGG KO K03012 > 

RIKEN DNA Bank Human Resource - POLR2D

Gene ID NCBI Gene 5433 |  KEGG hsa:5433
Gene Symbol POLR2D
Protein Name RNA polymerase II subunit D
Synonyms HSRBP4|HSRPB4|RBP4|RPB16
Ortholog resources KEGG ortholog (KEGG orthology K03012) in the DNA Bank
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083458 IRAL008K18 pOTB7 BC002958 NM_004805
HGY085079 IRAL012L15 pOTB7 BC017205 NM_004805 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000414 W01A001A14 pENTR-TOPO IRAL012L15 BC017205 NM_004805  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070406 ARe76A06 pKA1U5 NM_004805.3  
GTCCGGCGGCGCTGGTGGTGGCGCGCGGCGCGCCGNGGCGATGGCGGCGGGTGGCAGCGA
HKR405343 RBdS013F23 pGCAP10 NM_004805.3  
GGCTTCTGCTTCCGGCGGCGCTGGTGGTGGCGCGCGGCGCGGCGCGGCGCGGCGATGGCG
HKR433469 RBdS083L05 pGCAP10 NM_004805.3  
GGCGGCGCGGCGCGGCGATGGCGGCGGGTGGCAGCGATCCGCGGGCTGGCGACGTAGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl