Prev. |  KEGG KO K03010 > 

RIKEN DNA Bank Human Resource - POLR2B

Gene ID NCBI Gene 5431 |  KEGG hsa:5431
Gene Symbol POLR2B
Protein Name RNA polymerase II subunit B
Synonyms POL2RB|RPB2|hRPB140
Ortholog resources KEGG ortholog (KEGG orthology K03010) in the DNA Bank
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY028538 IRAK071F18 pBluescriptR BC046499 NM_000938 Partial
HGY082252 IRAL005K12 pOTB7 BC023503 NM_000938 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR420493 RBdS051D21 pGCAP10 NM_000938.1  
ACTTCGTCTTTAGCTCCTGGCGCTGCTGGCTTCTGGGCGGTTTTTGTCTTTTGATTTCAA
HKR462588 RBdS156H20 pGCAP10 NM_000938.1  
GGCGCTGCTGGCTTCTGGGCGGTTTTTGTCTTTTGATTTCAAGAGTTAGGAGCTCGAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl