Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - POLG

Gene ID (NCBI) 5428
Gene Symbol POLG
Protein Name polymerase (DNA directed), gamma
Synonyms MDP1|MIRAS|MTDPS4A|MTDPS4B|PEO|POLG1|POLGA|SANDO|SCAE
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02332)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010719 IRAK026N07 pCMV-SPORT6 BC042571 NM_002693 Full
HGX043086 IRAK107L22 pCMV-SPORT6 BC050559 NM_002693 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE092445 M01C031B21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092493 M01C031D21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092541 M01C031F21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092589 M01C031H21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092637 M01C031J21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092685 M01C031L21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092733 M01C031N21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092781 M01C031P21 pDONR221 MGC05-C11 BC042571 NM_002693  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172529 ARi31F09 pGCAP10 NM_002693.2  
GGCAGACGGGAAGTTGCGGCTGCCAGCGAAGCGGACCGGCCGGGTGGAGGCCACACGCTA
HKR070474 ARe76D02 pKA1U5 NM_002693.2  
GGGGTGCAGACGGGAAGTTGCGGCTGCCAGCGNACNTTNACCGGCCGGGTGGAGGCCACA
HKR074146 ARe85G02 pKA1U5 NM_002693.2  
GAGTTGCGGCTGCCAGCGAAGCGGACCGGCCGGGTGGAGGCCACACGCTACCCCGAGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl