Prev. |  KEGG KO K02332 > 

RIKEN DNA Bank Human Resource - POLG

Gene ID NCBI Gene 5428 |  KEGG hsa:5428
Gene Symbol POLG
Protein Name DNA polymerase gamma, catalytic subunit
Synonyms MDP1|MIRAS|MTDPS4A|MTDPS4B|PEO|POLG1|POLGA|SANDO|SCAE
Ortholog resource in our bank

  POLG

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010719 IRAK026N07 pCMV-SPORT6 BC042571 NM_002693 Full
HGX043086 IRAK107L22 pCMV-SPORT6 BC050559 NM_002693 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092445 M01C031B21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092493 M01C031D21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092541 M01C031F21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092589 M01C031H21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092637 M01C031J21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092685 M01C031L21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092733 M01C031N21 pDONR221 MGC05-C11 BC042571 NM_002693  
HGE092781 M01C031P21 pDONR221 MGC05-C11 BC042571 NM_002693  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070474 ARe76D02 pKA1U5 NM_002693.2  
GGGGTGCAGACGGGAAGTTGCGGCTGCCAGCGNACNTTNACCGGCCGGGTGGAGGCCACA
HKR074146 ARe85G02 pKA1U5 NM_002693.2  
GAGTTGCGGCTGCCAGCGAAGCGGACCGGCCGGGTGGAGGCCACACGCTACCCCGAGGCT
HKR172529 ARi31F09 pGCAP10 NM_002693.2  
GGCAGACGGGAAGTTGCGGCTGCCAGCGAAGCGGACCGGCCGGGTGGAGGCCACACGCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl