Prev. |  KEGG KO K16943 > 

RIKEN DNA Bank Human Resource - SEPTIN4

Gene ID NCBI Gene 5414 |  KEGG hsa:5414
Gene Symbol SEPTIN4
Protein Name septin 4
Synonyms ARTS|BRADEION|C17orf47|CE5B3|H5|MART|PNUTL2|SEP4|SEPT4|hCDCREL-2|hucep-7
Featured content Apoptosis - human
Ortholog resource in our bank

  SEPTIN4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013016 IRAK032I24 pBluescriptR BC018056 NM_080416 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR387701 RBd69E05 pGCAP10 NM_080415.1  
GGCTGCTGCGAGGTCGGCGCGCAGCTCCGCCGCGGGTCGCTCGGGCGCTGTCCAGGCGGA
HKR406243 RBdS015K03 pGCAP10 NM_080415.1  
GGAGGCGGGAGGGTGACGGCGGTGCTGCGAGGTCGGCGCGCAGCTCCGCCGCGGGTCGCT
HKR452815 RBdS132A15 pGCAP10 NM_080415.1  
GAGGGTGACGGCGGTGCTGCGAGGTCGGCGCGCAGCTCCGCCGCGGGTCGCTCGGGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl