Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SEPT4

Gene ID (NCBI) 5414
Gene Symbol SEPT4
Protein Name septin 4
Synonyms ARTS|BRADEION|CE5B3|H5|MART|PNUTL2|SEP4|hCDCREL-2|hucep-7
Databases KEGG hsa:5414 |  NCBI Gene 5414
Featured content Ortholog resources in the DNA Bank (KEGG orthology K16943)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY013016 IRAK032I24 pBluescriptR BC018056 NM_080416 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR387701 RBd69E05 pGCAP10 NM_080415.1  
GGCTGCTGCGAGGTCGGCGCGCAGCTCCGCCGCGGGTCGCTCGGGCGCTGTCCAGGCGGA
HKR406243 RBdS015K03 pGCAP10 NM_080415.1  
GGAGGCGGGAGGGTGACGGCGGTGCTGCGAGGTCGGCGCGCAGCTCCGCCGCGGGTCGCT
HKR452815 RBdS132A15 pGCAP10 NM_080415.1  
GAGGGTGACGGCGGTGCTGCGAGGTCGGCGCGCAGCTCCGCCGCGGGTCGCTCGGGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl