Prev. |  KEGG KO K13114 > 

RIKEN DNA Bank Human Resource - PNN

Gene ID NCBI Gene 5411 |  KEGG hsa:5411
Gene Symbol PNN
Protein Name pinin, desmosome associated protein
Synonyms DRS|DRSP|SDK3|memA
Ortholog resources KEGG ortholog (KEGG orthology K13114) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038971 W01A097H03 pENTR-TOPO IRAK135O07 BC062602 NM_002687  
HGE038973 W01A097H05 pENTR-TOPO IRAK135O07 BC062602 NM_002687  
HGE038979 W01A097H11 pENTR-TOPO IRAK135O07 BC062602 NM_002687  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042976 ARe07H08 pKA1U5 NM_002687.3  
GAAGCCTGCCGCAGGGAGAAGATGGCGGTCGCCGTAAGAACTTTGCAGGAACAGCTGGAA
HKR182930 ARi57F10 pGCAP10 NM_002687.3  
GAAAAGCAGTCTCAAGCCTGCCGCAGGGAGAAGATGGCGGTCGCCGTAAGAACTTTGCAG
HKR279491 ARiS198M03 pGCAP10 NM_002687.3  
GAGTCCTTTCGCGCCTCGGCGGCGCGGCATAGCCCGGCTCGGCCTGTAAAGCAGTCTCAA
HKR364050 RBd10C02 pGCAP10 NM_002687.3  
GAAAGCAGTCTCAAGCCTGCCGCAGGGAGAAGATGGCGGTCGCCGTAAGAACTTTGCAGG
HKR392025 RBd80B01 pGCAP10 NM_002687.3  
TGGAAAGCAGTCTCAAGCCTGCCGCAGGGAGAAGATGGCGGTCGCCGTAAGAACTTTGCA
HKR392874 RBd82D02 pGCAP10 NM_002687.3  
GGGCATAGCCCGGCTCGGCCTGTAAAGCAGTCTCAAGCCTGCCGCAGGGAGAAGATGGCG
HKR444268 RBdS110L04 pGCAP10 NM_002687.3  
GAAGCCTGCCGCAGGGAGAAGATGGCGGTCGCCGTGAGAACTTTGCAGGAACAGCTGGAA
HKR462567 RBdS156G23 pGCAP10 NM_002687.3  
GAAAAGCAGTCTCAAGCCTGCCGCAGGGAGAAGATGGCGGTCGCCGTGAGAACTTTGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl