Prev. |  KEGG KO K12591 > 

RIKEN DNA Bank Human Resource - EXOSC10

Gene ID NCBI Gene 5394 |  KEGG hsa:5394
Gene Symbol EXOSC10
Protein Name exosome component 10
Synonyms PM-Scl|PM/Scl-100|PMSCL|PMSCL2|RRP6|Rrp6p|p2|p3|p4
Ortholog resource in our bank

  EXOSC10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032921 IRAK082F01 pCMV-SPORT6 BC039901 NM_001001998 Full
HGY081089 IRAL002M01 pOTB7 BC009908 NM_001001998 Partial
HGY103332 IRAL058F12 pOTB7 BC073788 NM_001001998 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR346575 RBb66H07 pGCAP1 NM_002685.2  
GCTCCTCGGCCGACAAGCTCTCGCGAGACGAGCCGTGCAGGCTGAAAAAATGGCGCCACC
HKR406123 RBdS015F03 pGCAP10 NM_002685.2  
GAGGCTGAAAAAATGGCGCCACCCAGTACCCGGGAGCCCAGGGTCCTGTCGGCGACCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl