Prev. |  KEGG KO K19289 > 

RIKEN DNA Bank Human Resource - PMP22

Gene ID NCBI Gene 5376 |  KEGG hsa:5376
Gene Symbol PMP22
Protein Name peripheral myelin protein 22
Synonyms CIDP|CMT1A|CMT1E|DSS|GAS-3|GAS3|HMSNIA|HNPP|Sp110
Ortholog resources KEGG ortholog (KEGG orthology K19289) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY092279 IRAL030L15 pOTB7 BC019040 NM_153322 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100439 M01C051B15 pDONR221 MGC15-C08 BC019040 NM_153322  
HGE100487 M01C051D15 pDONR221 MGC15-C08 BC019040 NM_153322  
HGE100535 M01C051F15 pDONR221 MGC15-C08 BC019040 NM_153322  
HGE100583 M01C051H15 pDONR221 MGC15-C08 BC019040 NM_153322  
HGE100631 M01C051J15 pDONR221 MGC15-C08 BC019040 NM_153322  
HGE100679 M01C051L15 pDONR221 MGC15-C08 BC019040 NM_153322  
HGE100727 M01C051N15 pDONR221 MGC15-C08 BC019040 NM_153322  
HGE100775 M01C051P15 pDONR221 MGC15-C08 BC019040 NM_153322  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE050945 W01A127G01 pENTR-TOPO IRAL030L15 BC019040 NM_153322  
HGE050951 W01A127G07 pENTR-TOPO IRAL030L15 BC019040 NM_153322  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173372 ARi33H04 pGCAP10 NM_000304.2  
TGACTGCCCCCTTGCTTCGCGCGCGCGCAGCCCCGCAGCGCAGCTTTGGCGGCGCCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl