Prev. |  KEGG KO K10131 > 

RIKEN DNA Bank Human Resource - PMAIP1

Gene ID NCBI Gene 5366 |  KEGG hsa:5366
Gene Symbol PMAIP1
Protein Name phorbol-12-myristate-13-acetate-induced protein 1
Synonyms APR|NOXA
Featured content Apoptosis - human
Ortholog resource in our bank

  PMAIP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008494 IRAK021D22 pCMV-SPORT6 BC013120 NM_021127 Full
HGX027839 IRAK069J23 pCMV-SPORT6 BC032663 NM_021127 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR361650 RBd04C02 pGCAP10 NM_021127.2  
GAGAGTTTCCCGGGCACTCACCGTGTGTAGTTGGCATCTCCGCGCGTCCGGACACCCGAT
HKR364530 RBd11F10 pGCAP10 NM_021127.2  
CGGCCGGCCGATGACTGGACAAAAGCGTGGTCTCTGGCGCGGGGATCTCAGAGTTTCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl