Prev. |  KEGG KO K08761 > 

RIKEN DNA Bank Human Resource - PLTP

Gene ID NCBI Gene 5360 |  KEGG hsa:5360
Gene Symbol PLTP
Protein Name phospholipid transfer protein
Synonyms BPIFE|HDLCQ9
Ortholog resources KEGG ortholog (KEGG orthology K08761) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX017031 IRAK042J15 pCMV-SPORT6 BC019898 NM_006227 Full/var
HGX017059 IRAK042K19 pCMV-SPORT6 BC019847 NM_006227 Full/var
HGY087303 IRAL018E07 pOTB7 BC005045 NM_182676 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186030 ARi65B06 pGCAP10 NM_006227.2  
GAGACCCCGTCGCCCGGATCCCCTGAGCTGCCCGCCATCCCACGTGACCGCGCCGCCCCC
HKR219913 ARiS049N01 pGCAP10 NM_006227.2  
GGCCAGACCCCGTCGCCCGGATCCCCTGAGCTGCCCGCCATCCCACGTGACCGCGCCGCC
HKR219928 ARiS049N16 pGCAP10 NM_006227.2  
TTGGCCAGACCCCGTCGCCCGGATCCCCTGAGCTGCCCGCCATCCCACGTGACCGCGCCG
HKR222059 ARiS055C11 pGCAP10 NM_006227.2  
GGCCAGACCCCGTCGCCCGGATCCCCTGAGCTGCCCGCCATCCCACGTGACCGCGCCGCC
HKR238445 ARiS096B21 pGCAP10 NM_006227.2  
GGCCAGACCCCGTCGCCCGGATCCCCTGAGCTGCCCGCCATCCCACGTGACCGCGCCGCC
HKR324480 RBb11D08 pKA1U5 NM_006227.2  
AGACCCCGNTCGCCCGGATCCCCTGAGCTGCCCGCCATCCCACGNTGACCGCGCCGCCCC
HKR406304 RBdS015M16 pGCAP10 NM_006227.2  
GGCCAGACCCCGTCGCCCGGATCCCCTGAGCTGCCCGCCATCCCACGTGACCGCGCCGCC
HKR420534 RBdS051F14 pGCAP10 NM_006227.2  
GGCCAGACCCCGTCGCCCGGATCCCCTGAGCTGCCCGCCATCCCACGTGACCGCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl