Prev. |  KEGG KO K17336 > 

RIKEN DNA Bank Human Resource - PLS3

Gene ID NCBI Gene 5358 |  KEGG hsa:5358
Gene Symbol PLS3
Protein Name plastin 3
Synonyms BMND18|T-plastin
Ortholog resource in our bank

  PLS3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007849 IRAK019K09 pCMV-SPORT6 BC008588 NM_005032 Partial
HGX047849 IRAK119K09 pCMV-SPORT6 BC056898 NM_005032 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055607 ARe39A07 pKA1U5 NM_005032.3  
GAGGAGGGGAGGTCATCTCTGGCTTTATAGCCACACCTGCAAANATTCCGAGGCTGCACA
HKR164451 ARi11C03 pGCAP10 NM_005032.3  
GGGTGCAGAAGTTGTCTGAGTGGGTTGGTCGGCGGCAGTCGGGCCAGACCCAGGACTCTG
HKR175673 ARi39D01 pGCAP10 NM_005032.3  
GGCAGAAGTTGTCTGAGTGGGTTGGTCGGCGGCAGTCGGGCCAGACCCAGGACTCTGCGA
HKR183771 ARi59H03 pGCAP10 NM_005032.3  
GGCAGAAGTTGTCTGAGTGGGTTGGTCGGCGGCAGTCGGGCCAGACCCAGGACTCTGCGA
HKR238673 ARiS096L09 pGCAP10 NM_005032.3  
GACACAGCTGCAAAGATTCCGAGGTGCANAAGTTGTCTGAGTGGGTTGGTCGGCGGCAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl