Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PKM

Gene ID (NCBI) 5315
Gene Symbol PKM
Protein Name pyruvate kinase, muscle
Synonyms CTHBP|HEL-S-30|OIP3|PK3|PKM2|TCB|THBP1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008473 IRAK021D01 pCMV-SPORT6 BC035198 NM_002654 Full/var
HGY080777 IRAL001P17 pOTB7 BC000481 NM_002654 Full
HGY082634 IRAL006J18 pOTB7 BC019265 NM_002654 Partial
HGY084097 IRAL010E01 pOTB7 BC012811 NM_002654 Full/var
HGY088280 IRAL020L16 pOTB7 BC007952 NM_002654 Full
HGY089403 IRAL023I11 pOTB7 BC007640 NM_002654 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025517 W01A063N05 pENTR-TOPO IRAL023I11 BC007640 NM_002654  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044012 ARe10A12 pKA1U5 NM_002654.3  
GAGGCTGAGGCAGTGGCTCCTTGCANNGGCAGCTGCACGCGCCGCTGGCTCCNGATCTCT
HKR044059 ARe10C11 pKA1U5 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR046556 ARe16G12 pKA1U5 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGNTGGCTCCGGATCTNTTCGTCTTTGCAGCGTAGCCCGA
HKR164452 ARi11C04 pGCAP10 NM_002654.3  
CGGCCGGCCGATGGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCA
HKR167282 ARi18D10 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR048459 ARe21C11 pKA1U5 NM_002654.3  
GAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGCTGGCTCCGGATCTCTTCGTCTTTGCA
HKR050874 ARe27D02 pKA1U5 NM_002654.3  
TAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGCTGGCTCCGGATCTCTTCGTCTTTGCA
HKR051369 ARe28H01 pKA1U5 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR168532 ARi21F12 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR169254 ARi23C06 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR170408 ARi26A08 pGCAP10 NM_002654.3  
GAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAG
HKR171751 ARi29G07 pGCAP10 NM_002654.3  
GACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAGTC
HKR052053 ARe30C05 pKA1U5 NM_002654.3  
ATGGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCG
HKR176809 ARi42A09 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR060402 ARe51A02 pKA1U5 NM_002654.3  
GAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGNTGGCTCCGGATCTCTTCGTCTTTGCA
HKR061281 ARe53D09 pKA1U5 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGNTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGA
HKR061746 ARe54G02 pKA1U5 NM_002654.3  
GGCACAGCAGCCTGCACGCGCCGNTGGCTTCCGGATCTCTTCGTCTTTGCAGCGTAGCCC
HKR062805 ARe57A05 pKA1U5 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR063626 ARe59B02 pKA1U5 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR063751 ARe59G07 pKA1U5 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTTCGTCTTTGCAGCGTAGCCCGA
HKR182873 ARi57D01 pGCAP10 NM_002654.3  
TGGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGA
HKR185374 ARi63H06 pGCAP10 NM_002654.3  
TGGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCT
HKR187277 ARi68D05 pGCAP10 NM_002654.3  
GAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTC
HKR188148 ARi70G04 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR188428 ARi71B04 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR076428 ARe91B04 pKA1U5 NM_002654.3  
GGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGC
HKR203524 ARiS008N12 pGCAP10 NM_002654.3  
GGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTT
HKR209288 ARiS023D16 pGCAP10 NM_002654.3  
GGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTT
HKR209429 ARiS023J13 pGCAP10 NM_002654.3  
TGGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGA
HKR209491 ARiS023M03 pGCAP10 NM_002654.3  
GGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTG
HKR218375 ARiS045P15 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR222070 ARiS055C22 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR222249 ARiS055K09 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR234022 ARiS085A22 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR234064 ARiS085C16 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR234116 ARiS085E20 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR234336 ARiS085N24 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR234894 ARiS087D22 pGCAP10 NM_002654.3  
HKR235145 ARiS087O09 pGCAP10 NM_002654.3  
HKR238674 ARiS096L10 pGCAP10 NM_002654.3  
GGCACNNCAGCTGCACNCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTANCCCNAG
HKR264454 ARiS161C06 pGCAP10 NM_002654.3  
GAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAGTCGG
HKR276664 ARiS191K24 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR279312 ARiS198E16 pGCAP10 NM_002654.3  
GGAGGCNGAGGCAGTGGCTCCTNGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTT
HKR279464 ARiS198K24 pGCAP10 NM_002654.3  
HKR321331 RBb03F11 pKA1U5 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGATCTTTGCAGCGTAGCCCGA
HKR361379 RBd03H11 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR363233 RBd08B09 pGCAP10 NM_002654.3  
HKR325280 RBb13D08 pKA1U5 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR325626 RBb14B02 pKA1U5 NM_002654.3  
HKR366059 RBd15C11 pGCAP10 NM_002654.3  
GAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTC
HKR367328 RBd18F08 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR329655 RBb24C07 pGCAP1 NM_002654.3  
GAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTTAGCCCGAGTCGGTC
HKR368148 RBd20G04 pGCAP10 NM_002654.3  
GGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTT
HKR368404 RBd21A04 pGCAP10 NM_002654.3  
GCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCC
HKR368553 RBd21G09 pGCAP10 NM_002654.3  
GAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTC
HKR368954 RBd22G10 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR332030 RBb30B06 pGCAP1 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR332925 RBb32F05 pGCAP1 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR335280 RBb38D08 pGCAP1 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR374177 RBd35H09 pGCAP10 NM_002654.3  
GGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTT
HKR339225 RBb48B01 pGCAP1 NM_002654.3  
GTGGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCG
HKR376401 RBd41A01 pGCAP10 NM_002654.3  
GGGCTGCCCTCCCGGAGGTCCGTTCTGTCTGTCAGCCGCTTTGGTACGCTGCATCGGGAT
HKR376436 RBd41B12 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR378026 RBd45B02 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR378453 RBd46C05 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR379330 RBd48F10 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR342435 RBb56B11 pGCAP1 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGA
HKR381721 RBd54F01 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCNNNNNNNNGTAGCCCGAG
HKR381772 RBd54H04 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR347602 RBb69A02 pGCAP1 NM_002654.3  
GGGGCGAGGCGGTGGATCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTA
HKR386128 RBd65F08 pGCAP10 NM_002654.3  
GGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGC
HKR348147 RBb70G03 pGCAP1 NM_002654.3  
AGGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTT
HKR348179 RBb70H11 pGCAP1 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR348556 RBb71G12 pGCAP1 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR390801 RBd77A01 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR391723 RBd79F03 pGCAP10 NM_002654.3  
GGCACNGCNNCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR392573 RBd81H05 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR402900 RBdS007E04 pGCAP10 NM_002654.3  
GGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTG
HKR405326 RBdS013F06 pGCAP10 NM_002654.3  
GAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAGTCGGTCA
HKR405672 RBdS014C24 pGCAP10 NM_002654.3  
GGGCATTCTGGCGCGGAGCGGAGCGGCGGCGGGCGCAGCTAGCGGGTCGGCCGCGGAGCG
HKR405711 RBdS014E15 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR416068 RBdS040C20 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR428336 RBdS070N24 pGCAP10 NM_002654.3  
GGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTT
HKR430250 RBdS075K10 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR432477 RBdS081D05 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR442371 RBdS105P11 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR461947 RBdS154O11 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG
HKR462580 RBdS156H12 pGCAP10 NM_002654.3  
GGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl