Prev. | 

RIKEN DNA Bank Human Resource - PITPNA

Gene ID NCBI Gene 5306 |  KEGG hsa:5306
Gene Symbol PITPNA
Protein Name phosphatidylinositol transfer protein alpha
Synonyms HEL-S-36|PI-TPalpha|PITPN|VIB1A
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY066897 IRAK167E01 pBluescriptR BC068538 NM_006224 Partial/var
HGY097822 IRAL044J06 pOTB7 BC045108 NM_006224
HGY103919 IRAL059N07 pOTB7 BC082976 NM_006224 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE111227 M01C078B03 pDONR221 06-2_02-G02 BC045108 NM_006224  
HGE111275 M01C078D03 pDONR221 06-2_02-G02 BC045108 NM_006224  
HGE111323 M01C078F03 pDONR221 06-2_02-G02 BC045108 NM_006224  
HGE111371 M01C078H03 pDONR221 06-2_02-G02 BC045108 NM_006224  
HGE111419 M01C078J03 pDONR221 06-2_02-G02 BC045108 NM_006224  
HGE111467 M01C078L03 pDONR221 06-2_02-G02 BC045108 NM_006224  
HGE111515 M01C078N03 pDONR221 06-2_02-G02 BC045108 NM_006224  
HGE092016 M01C030A16 pDONR221 MGC04-F08 BC045108 NM_006224  
HGE092064 M01C030C16 pDONR221 MGC04-F08 BC045108 NM_006224  
HGE092112 M01C030E16 pDONR221 MGC04-F08 BC045108 NM_006224  
HGE092160 M01C030G16 pDONR221 MGC04-F08 BC045108 NM_006224  
HGE092208 M01C030I16 pDONR221 MGC04-F08 BC045108 NM_006224  
HGE092256 M01C030K16 pDONR221 MGC04-F08 BC045108 NM_006224  
HGE092304 M01C030M16 pDONR221 MGC04-F08 BC045108 NM_006224  
HGE092352 M01C030O16 pDONR221 MGC04-F08 BC045108 NM_006224  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062855 ARe57C07 pKA1U5 NM_006224.3  
GGGAGCTCCGGGCGGCGTCGGCAGCGGCGCGAGAGGCGACGAGGCCCGGGCGGCAGGAGC
HKR184928 ARi62F08 pGCAP10 NM_006224.3  
GCTGGTTGCCGCAGAGACGCCCCGCCCCCGCGCGGCGCTGCGGAACCGGAGCTCCGGGCG
HKR326126 RBb15F06 pKA1U5 NM_006224.3  
GGCCCCGCCCCCGCGCGGCGCTGCGGAACCGGANCTNCNGGCGGCGTCGGCAGCGGCGCG
HKR364526 RBd11F06 pGCAP10 NM_006224.3  
TNCTTNGAGACGCCCCGCCCCCGCGCGGCGCTGCGGAACCGGAGCTCCGGGCGGCGTCCG
HKR368402 RBd21A02 pGCAP10 NM_006224.3  
GGCGGAACCGGAGCTCCGGGCGGCGTCGGCAGCGGCGCGAGAGGCGACGAGGCCCGGGCG
HKR374873 RBd37D01 pGCAP10 NM_006224.3  
GAGCGGCGCGAGAGGCGACGAGGCCCGGGCGGCAGGAGCCGGCGCGGCGACCGCGGCGAG
HKR408889 RBdS022D17 pGCAP10 NM_006224.3  
GAGCGGCGCGAGAGGCGACGAGGCCCGGGCGGCAGGAGCCGGCGCGGCGACCGCGGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl