Prev. |  KEGG KO K09578 > 

RIKEN DNA Bank Human Resource - PIN1

Gene ID NCBI Gene 5300 |  KEGG hsa:5300
Gene Symbol PIN1
Protein Name peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Synonyms DOD|UBL5
Ortholog resources KEGG ortholog (KEGG orthology K09578) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086297 IRAL015M09 pOTB7 BC002899 NM_006221 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004267 W01A010L03 pENTR-TOPO IRAL015M09 BC002899 NM_006221  
HGE004271 W01A010L07 pENTR-TOPO IRAL015M09 BC002899 NM_006221  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056855 ARe42C07 pKA1U5 NM_006221.2  
GGGCAGGAGGGAAGATGGCGGACGAGGAGAAGCTGCCGCCCGGCTGGGAGAAGCGCATGA
HKR183702 ARi59E06 pGCAP10 NM_006221.2  
GGCGCTGCGGCAGGAGGGAAGATGGCGGACGAGGAGAAGCTGCCGCCCGGCTGGGAGAAG
HKR219623 ARiS049A23 pGCAP10 NM_006221.2  
GGGAGCAGGCGCTGCGGCAGGAGGGAAGATGGCGGACGAGGAGAAGCTGCCGCCCGGCTG
HKR260092 ARiS150D20 pGCAP10 NM_006221.2  
GAGGAGGGAAGATGGCGGACGANNAGAAGCTGCCGCCCGGCTGGGAGAAGCGCATGAGCC
HKR322408 RBb06A08 pKA1U5 NM_006221.2  
TGGGCAGGAGGGAAGATGGCGGACGAGGAGAAGCTGTCGCCCGGCTGGGAGAAGCGCATG
HKR335252 RBb38C04 pGCAP1 NM_006221.2  
GGGAGCAGGCGCTGCGGCAGGAGGGAAGATGGCGGACGAGGAGAAGCTGTCGCCCGGCTG
HKR393673 RBd84D01 pGCAP10 NM_006221.2  
GAGGCGCTGCGGCAGGAGGGAAGATGGCGGACGAGGAGAAGCTGTCGCCCGGCTGGGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl