Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PIK3R2

Gene ID (NCBI) 5296
Gene Symbol PIK3R2
Protein Name phosphoinositide-3-kinase regulatory subunit 2
Synonyms MPPH|MPPH1|P85B|p85|p85-BETA
Databases KEGG hsa:5296 |  NCBI Gene 5296
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Jak-STAT signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02649)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY067500 IRAK168M12 pBluescriptR BC070082 NM_005027
HGY091498 IRAL028M10 pOTB7 BC011917 NM_005027 Partial
HGY092196 IRAL030I04 pOTB7 BC014170 NM_005027 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050500 ARe26E04 pKA1U5 NM_005027.2  
ATCCTGTGGGGAGCCACGGGGCGGGCTTGGCTTGGTGTGACGGCGGCTGCGGCGGCGGTG
HKR186076 ARi65D04 pGCAP10 NM_005027.2  
GGGCGGCTGCGGCGGCGGTGGCGGCCGCGACCAGGTCGGCGTCCTCAGCTGGCCGAGCAT
HKR380479 RBd51D07 pGCAP10 NM_005027.2  
GGGGGATCCCGCGGCTGCGGCGACGGTGGCCGCGGTGGAGCCACGGGGCGGGCTTGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl