Prev. |  KEGG KO K16643 > 

RIKEN DNA Bank Human Resource - SERPINE2

Gene ID NCBI Gene 5270 |  KEGG hsa:5270
Gene Symbol SERPINE2
Protein Name serpin family E member 2
Synonyms GDN|GDNPF|PI-7|PI7|PN-1|PN1|PNI
Ortholog resource in our bank

  SERPINE2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028687 IRAK071L23 pBluescriptR BC042628 NM_006216 Full/var
HGY093225 IRAL033B01 pOTB7 BC015663 NM_006216

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331681 RBb29D09 pGCAP1 NM_006216.2  
GGCGCTGTGGGGCTGCCCGGGCTGCGCGGCGTCTGCAGGCGCCACCGCTGCCTCTTTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl