Prev. |  KEGG KO K03984 > 

RIKEN DNA Bank Human Resource - SERPINA1

Gene ID NCBI Gene 5265 |  KEGG hsa:5265
Gene Symbol SERPINA1
Protein Name serpin family A member 1
Synonyms A1A|A1AT|AAT|PI|PI1|PRO2275|alpha1AT|nNIF
Ortholog resource in our bank

  SERPINA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05465 pKM2L-phAAT Promoter Bank clone, Human alpha-1-antitrypsin (AAT) promoter
RDB05862 pAxit-phAAT-rLuc (F) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.
RDB05863 pAxit-phAAT-rLuc (R) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008478 IRAK021D06 pCMV-SPORT6 BC011991 NM_001002236 Full/var
HGY093316 IRAL033E20 pOTB7 BC015642 NM_001002236 Full/var
HGY102953 IRAL057G09 pDNR-LIB BC070163 NM_001002236 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218037 ARiS045B13 pGCAP10 NM_000295.4  
GGCAGCNACCCTCAGAGTCCTGAGCTGAACCAAGAAGGAGGAGGGGGTCGGGCCTCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl