Prev. |  KEGG KO K15636 > 

RIKEN DNA Bank Human Resource - PGM5

Gene ID NCBI Gene 5239 |  KEGG hsa:5239
Gene Symbol PGM5
Protein Name phosphoglucomutase 5
Synonyms PGMRP
Ortholog resources KEGG ortholog (KEGG orthology K15636) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097295 IRAL043D23 pOTB7 BC033073 NM_021965 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100848 M01C052B24 pDONR221 MGC15-H12 BC033073 NM_021965  
HGE100896 M01C052D24 pDONR221 MGC15-H12 BC033073 NM_021965  
HGE100944 M01C052F24 pDONR221 MGC15-H12 BC033073 NM_021965  
HGE100992 M01C052H24 pDONR221 MGC15-H12 BC033073 NM_021965  
HGE101040 M01C052J24 pDONR221 MGC15-H12 BC033073 NM_021965  
HGE101088 M01C052L24 pDONR221 MGC15-H12 BC033073 NM_021965  
HGE101136 M01C052N24 pDONR221 MGC15-H12 BC033073 NM_021965  
HGE101184 M01C052P24 pDONR221 MGC15-H12 BC033073 NM_021965  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038772 W01A096P12 pENTR-TOPO IRAL043D23 BC033073 NM_021965  
HGE038778 W01A096P18 pENTR-TOPO IRAL043D23 BC033073 NM_021965  
HGE038780 W01A096P20 pENTR-TOPO IRAL043D23 BC033073 NM_021965  
HGE038782 W01A096P22 pENTR-TOPO IRAL043D23 BC033073 NM_021965  
HGE048109 W01A120E13 pENTR-TOPO IRAL043D23 BC033073 NM_021965  
HGE048111 W01A120E15 pENTR-TOPO IRAL043D23 BC033073 NM_021965  
HGE048113 W01A120E17 pENTR-TOPO IRAL043D23 BC033073 NM_021965  
HGE048115 W01A120E19 pENTR-TOPO IRAL043D23 BC033073 NM_021965  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162121 ARi05F01 pGCAP10 NM_021965.3  
TTTTTTTTTTTATTTTTGGCTGAGGCTGTTCGCTGATGGCAAAAGGTTTCAGCCCCCTCC
HKR181675 ARi54D03 pGCAP10 NM_021965.3  
GACTCCCAGGGAGACAGGGGACGGGCCTGGCGCCGGAGAGGAGCCCGCACTCTGCCCGAA
HKR184579 ARi61H11 pGCAP10 NM_021965.3  
GACTCCCAGGGAGACAGGGGACGGGCCTGGCGCCGGAGAGGAGCCCGCACTCTGCCCGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl