Prev. |  KEGG KO K05759 > 

RIKEN DNA Bank Human Resource - PFN1

Gene ID NCBI Gene 5216 |  KEGG hsa:5216
Gene Symbol PFN1
Protein Name profilin 1
Synonyms ALS18
Ortholog resources KEGG ortholog (KEGG orthology K05759) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04720 pAxCALNLhPFN1(forward) Shuttle vector to generate rAd expressing human PFN1
RDB05016 pAxCALNLhPFN1(forward) Shuttle vector to generate rAd expressing human PFN1
RDB05017 pAxCALNLhPFN1(reverse) Shuttle vector to generate rAd expressing human PFN1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001393 IRAK003I01 pCMV-SPORT6 BC006768 NM_005022 Full
HGX005814 IRAK014I22 pCMV-SPORT6 BC013439 NM_005022 Full
HGY053260 IRAK133C12 pBluescript BC057828 NM_005022 Full
HGY082186 IRAL005H18 pOTB7 BC002475 NM_005022 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041306 ARe03E10 pKA1U5 NM_005022.2  
GAGGAGCAGGAAGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGATCCGGA
HKR044906 ARe12E10 pKA1U5 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTTGCCCCGAGCTCTCCGCCTCCCC
HKR047725 ARe19F05 pKA1U5 NM_005022.2  
GGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCC
HKR052083 ARe30D11 pKA1U5 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCC
HKR056004 ARe40A04 pKA1U5 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR059728 ARe49F08 pKA1U5 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR063727 ARe59F07 pKA1U5 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR064499 ARe61E03 pKA1U5 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCCCNTTGNCCCGAGCTCTCCGCCTCCCC
HKR064573 ARe61H05 pKA1U5 NM_005022.2  
GGCGGTGCGAGGGCTGCTGCACAGCGAGCGGACCCTTNNNTCCGGACGGCAGCGCGTGCC
HKR068105 ARe70E09 pKA1U5 NM_005022.2  
GGGAGCAGGAAGTGGCGGTGCGAGGGCTGCTGCACANCGAGCGGAGCCGCGGTCCGGACG
HKR071601 ARe79A01 pKA1U5 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR162429 ARi06B05 pGCAP10 NM_005022.2  
GAGGAAGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGC
HKR162971 ARi07H03 pGCAP10 NM_005022.2  
GACCGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCCAGCTCTCCGCCTCCCCC
HKR168150 ARi20G06 pGCAP10 NM_005022.2  
GGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCC
HKR168812 ARi22A12 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR170431 ARi26B07 pGCAP10 NM_005022.2  
GAGGAGCAGGAAGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGAC
HKR174826 ARi37B02 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR176547 ARi41G03 pGCAP10 NM_005022.2  
GCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCCCGCCCGCCAGCCGAGGCAGC
HKR178432 ARi46B08 pGCAP10 NM_005022.2  
CGGCCGGCCGATGACACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGC
HKR178809 ARi47A09 pGCAP10 NM_005022.2  
GCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCCCGCCCGCCAGCCGAGGCAGC
HKR179378 ARi48H10 pGCAP10 NM_005022.2  
TGGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCC
HKR180552 ARi51G08 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR180810 ARi52A10 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR181283 ARi53D11 pGCAP10 NM_005022.2  
GAAGGGCGGGCCTTCCGGGGTCAGGACGCGTGGGTGTGCCCNGTCCTGTCCGCCTCCCCC
HKR184523 ARi61F03 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR186475 ARi66D03 pGCAP10 NM_005022.2  
GAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCCCG
HKR218058 ARiS045C10 pGCAP10 NM_005022.2  
GAGCAGGAAGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGACGGC
HKR219726 ARiS049F06 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR234244 ARiS085K04 pGCAP10 NM_005022.2  
GAGGAGCAGGANGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGAC
HKR234990 ARiS087H22 pGCAP10 NM_005022.2  
HKR235021 ARiS087J05 pGCAP10 NM_005022.2  
CGGGAGCAGGAANTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGAC
HKR235321 ARiS088F01 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR238489 ARiS096D17 pGCAP10 NM_005022.2  
GGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCCCGCCC
HKR243742 ARiS109F22 pGCAP10 NM_005022.2  
GGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCC
HKR247427 ARiS118J11 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR260225 ARiS150J09 pGCAP10 NM_005022.2  
GGCTGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCT
HKR260267 ARiS150L03 pGCAP10 NM_005022.2  
GAGGAGCANGAAGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGAC
HKR276612 ARiS191I20 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR323677 RBb09D05 pKA1U5 NM_005022.2  
TTGGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTT
HKR323678 RBb09D06 pKA1U5 NM_005022.2  
GACACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGATGCCCCGAGCTCTCCGCCTCC
HKR343255 RBb58C07 pGCAP1 NM_005022.2  
GAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCCCG
HKR347722 RBb69F02 pGCAP1 NM_005022.2  
GGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCCCGCCC
HKR348502 RBb71E06 pGCAP1 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR360859 RBd02C11 pGCAP10 NM_005022.2  
GGCCAGCCGAGGCAGCTCGAGCCCAGTCCGCGGCCCCAGCAGCAGCGCCGAGAGCAGCCC
HKR373257 RBd33C09 pGCAP10 NM_005022.2  
GGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCC
HKR382878 RBd57D06 pGCAP10 NM_005022.2  
GGGCCCCGGCGCAGGCGCAGGCGCGGGCACACGCGCCGCCGCCCGNCGGTCCTTCCCTTC
HKR384007 RBd60A07 pGCAP10 NM_005022.2  
GGAGCAGGAAGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGACGG
HKR387631 RBd69B07 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR389774 RBd74H06 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR396907 RBd92E11 pGCAP10 NM_005022.2  
GGGAGCAGGAAGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGACG
HKR405678 RBdS014D06 pGCAP10 NM_005022.2  
GAGGAGCAGGAAGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGAC
HKR405709 RBdS014E13 pGCAP10 NM_005022.2  
GGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCC
HKR416200 RBdS040I08 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR430032 RBdS075B08 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR430202 RBdS075I10 pGCAP10 NM_005022.2  
GATGCACTCCCGGCCCCGGCGCAGGCGCAGGCGCGGGCACACGCGCCGCCGCCCGCCGGT
HKR462626 RBdS156J10 pGCAP10 NM_005022.2  
GACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCC
HKR470814 RBdS177A14 pGCAP10 NM_005022.2  
GGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl