Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PFKL

Gene ID (NCBI) 5211
Gene Symbol PFKL
Protein Name phosphofructokinase, liver
Synonyms PFK-B
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content HIF-1 signaling pathway - human


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX007637 IRAK019B13 pCMV-SPORT6 BC018295 NM_002626 Partial
HGY081224 IRAL003A24 pOTB7 BC009919 NM_002626 Full/var
HGY084276 IRAL010L12 pOTB7 BC008964 NM_002626 Full/var
HGY084434 IRAL011B10 pOTB7 BC004920 NM_002626 Partial
HGY087550 IRAL018O14 pOTB7 BC006422 NM_001002021 Full
HGY089065 IRAL022L01 pOTB7 BC007536 NM_002626 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE043170 W01A107P10 pENTR-TOPO IRAL018O14 BC006422 NM_001002021  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051350 ARe28G06 pKA1U5 NM_002626.4  
GGGGGACGGCGACGCGGCGCAGGCGGCGGGAGTGCNAGCTGGGCCCGTGATTTCGGCCGC
HKR070829 ARe77B05 pKA1U5 NM_002626.4  
TGGTTTCGGCCGCCGCCATGGCCGCGGTGGACCTGTTAGAAGCTGCGGGCGTCGGGCGCG
HKR074577 ARe86H09 pKA1U5 NM_002626.4  
GGACGCGGCGCAGGCGGCGGGAGTGCGAGCTGNGNCCGATGNTTTCGGCCGCCGCCATGG
HKR247540 ARiS118O04 pGCAP10 NM_002626.4  
GGGGAGTGNGAGCTGGGCCCGTGTTTCGGCCGCCGCCATGGCCGCGGTGGACCTGGAGAA
HKR392083 RBd80D11 pGCAP10 NM_002626.4  
GGTTTCGGCCGCCGCCATGGCCGCGGTGGACCTGGAGAAGCTGCGGGCGTCGGGCGCGGG
HKR393769 RBd84H01 pGCAP10 NM_002626.4  
GGGGAGTGCGAGCTGGGCCCGTGTTTCGGCCGCCGCCATGGCCGCGGTGGACCTGGAGAA
HKR399249 RBd98C01 pGCAP10 NM_002626.4  
GGCAGGCGGCGGGAGTGCGAGCTGGGCCCGTGTTTCGGCCGCCGCCATGGCCGCGGTGGA
HKR428313 RBdS070N01 pGCAP10 NM_002626.4  
GGTGTTTCGGCCGCCGCCATGGCCGCGGTGGACCTGGAGAAGCTGCGGGCGTCGGGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl