Prev. |  KEGG KO K09550 > 

RIKEN DNA Bank Human Resource - PFDN4

Gene ID NCBI Gene 5203 |  KEGG hsa:5203
Gene Symbol PFDN4
Protein Name prefoldin subunit 4
Synonyms C1|PFD4
Ortholog resources KEGG ortholog (KEGG orthology K09550) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087834 IRAL019J18 pDNR-LIB BC010953 NM_002623 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021110 W01A052M22 pENTR-TOPO IRAL019J18 BC010953 NM_002623  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR208067 ARiS020C19 pGCAP10 NM_002623.3  
GAGTCCAGTCCCAAGATGGCGGCCACCATGAAGAAGGCGGCTGCAGAAGATGTCAATGTT
HKR276432 ARiS191B08 pGCAP10 NM_002623.3  
GAGTCCAGTCCCAAGATGGCGGCCACCATGAAGAAGGCGGCTGCAGAAGATGTCAATGTT
HKR345235 RBb63B11 pGCAP1 NM_002623.3  
TGCGCCAACCATGGCGGCCGCCTGATAAACGCGGCTGCACCAGATGTCATGTTACTTTCG
HKR396455 RBd91C07 pGCAP10 NM_002623.3  
GAGTCCAGTCCCAAGATGGCGGCCACCATGAAGAAGGCGGCTGCAGAAGATGTCAATGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl