Prev. |  KEGG KO K09549 > 

RIKEN DNA Bank Human Resource - PFDN2

Gene ID NCBI Gene 5202 |  KEGG hsa:5202
Gene Symbol PFDN2
Protein Name prefoldin subunit 2
Synonyms PFD2
Ortholog resources KEGG ortholog (KEGG orthology K09549) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011445 IRAK028K05 pCMV-SPORT6 BC012464 NM_012394 Full
HGX037554 IRAK093O18 pCMV-SPORT6 BC047042 NM_012394 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051232 ARe28B08 pKA1U5 NM_012394.3  
GAGGCGGCGAAGATGGCGGAGAACAGCGGTCGCGCCGGCAAGAGCAGCGGGAGCGGCGCG
HKR058059 ARe45C11 pKA1U5 NM_012394.3  
GGGAAACCCAGCAGGCGGCGAAGATGGCGGAGAACAGCGGTCGCGCCGGCAAGAGCAGCG
HKR064812 ARe62A12 pKA1U5 NM_012394.3  
GGCGAAGATGGCGGAGAACAGCGGTCGCGCCGGCAAGAGCAGCGGGAGCGGCGCGGGGAA
HKR326055 RBb15C07 pKA1U5 NM_012394.3  
GAGGCGGCGAAGATGGCGGAGAACAGCGGTCGCNCCTGCAAGAGCAGCGGGAGCGGCGCG
HKR366057 RBd15C09 pGCAP10 NM_012394.3  
GACCCAGCAGGCGGCGAAGATGGCGGAGAACAGCGGTCGCGCCGGCAAGAGCAGCGGGAG
HKR394977 RBd87H09 pGCAP10 NM_012394.3  
GGAGCTGCGCCGGCCGGAAACCCAGCAGGCGGCGAAGATGGCGGAGAACAGCGGTCGCGC
HKR396102 RBd90E06 pGCAP10 NM_012394.3  
GGGAAACCCAGCAGGCGGCGAAGATGGCGGAGAACAGCGGTCGCGCCGGCAAGAGCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl