Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GATB

Gene ID (NCBI) 5188
Gene Symbol GATB
Protein Name glutamyl-tRNA amidotransferase subunit B
Synonyms HSPC199|PET112|PET112L
Databases KEGG hsa:5188 |  NCBI Gene 5188
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02434)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047683 ARe19D11 pKA1U5 NM_004564.1  
GGGAGTTACAATGGCGGCGCCCATGCTGCGCTGGGGCTGCCGTGGAAGACGTTGGGCTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl