Prev. |  KEGG KO K14213 > 

RIKEN DNA Bank Human Resource - PEPD

Gene ID NCBI Gene 5184 |  KEGG hsa:5184
Gene Symbol PEPD
Protein Name peptidase D
Synonyms PROLIDASE
Ortholog resources KEGG ortholog (KEGG orthology K14213) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006269 IRAK015L05 pCMV-SPORT6 BC015027 NM_000285
HGX011656 IRAK029C08 pCMV-SPORT6 BC028295 NM_000285
HGY085350 IRAL013G06 pOTB7 BC004305 NM_000285

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320576 RBb01H08 pKA1U5 NM_000285.2  
GGCACTTCACGTGACNCCGGATGCCGGGCGAACATGGCGGCGGCCACCGGACCCTCGTTT
HKR433444 RBdS083K04 pGCAP10 NM_000285.2  
GGCACTTCACGTGACGCCGGTGCCGGGCGAACATGGCGGCGGCCACCGGACCCTCGTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl