Prev. |  KEGG KO K19614 > 

RIKEN DNA Bank Human Resource - SERPINF1

Gene ID NCBI Gene 5176 |  KEGG hsa:5176
Gene Symbol SERPINF1
Protein Name serpin family F member 1
Synonyms EPC-1|OI12|OI6|PEDF|PIG35
Ortholog resources KEGG ortholog (KEGG orthology K19614) in the DNA Bank
Featured content Wnt signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080672 IRAL001L08 pOTB7 BC000522 NM_002615 Full
HGY084115 IRAL010E19 pOTB7 BC000522 NM_002615 Full
HGY091225 IRAL028B01 pOTB7 BC013984 NM_002615 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR322150 RBb05G06 pKA1U5 NM_002615.4  
GAGTGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTATCCACAGGCCCC
HKR347780 RBb69H12 pGCAP1 NM_002615.4  
GAGTGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTATCCACAGGCCCC
HKR348146 RBb70G02 pGCAP1 NM_002615.4  
GGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTATCCACAGGCCCCAGG
HKR371729 RBd29F09 pGCAP10 NM_002615.4  
CGGCCGGCCGATGAGTGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTA
HKR376453 RBd41C05 pGCAP10 NM_002615.4  
GGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTATCCACAGGCCCCAGG
HKR380547 RBd51G03 pGCAP10 NM_002615.4  
GAGTGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTATCCACAGGCCCC
HKR444232 RBdS110J16 pGCAP10 NM_002615.4  
GAGTGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTATCCACAGGCCCC
HKR461834 RBdS154J18 pGCAP10 NM_002615.4  
GAGTGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTATCCACAGGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl