Prev. |  KEGG KO K00898 > 

RIKEN DNA Bank Human Resource - PDK2

Gene ID NCBI Gene 5164 |  KEGG hsa:5164
Gene Symbol PDK2
Protein Name pyruvate dehydrogenase kinase 2
Synonyms PDHK2|PDKII
Ortholog resource in our bank

  PDK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085921 IRAL014N09 pOTB7 BC005811 NM_002611 Full
HGY096616 IRAL041I24 pDNR-LIB BC040478 NM_002611
HGY100541 IRAL051F21 pDNR-LIB BC063137 NM_002611 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037835 W01A094J19 pENTR-TOPO IRAL014N09 BC005811 NM_002611  
HGE037873 W01A094L09 pENTR-TOPO IRAL014N09 BC005811 NM_002611  
HGE037875 W01A094L11 pENTR-TOPO IRAL014N09 BC005811 NM_002611  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063300 ARe58E04 pKA1U5 NM_002611.3  
GGCCGCCGCAGCCATGCGCTGGGTGTGGGCGCTGCTGAAGAATGCGTCCCTGGCAGGGGC
HKR063324 ARe58F04 pKA1U5 NM_002611.3  
GGCCGACCGCAACCATGCGCTGGGTGTGGGCGCTGCTGAAGAATGCGTCCCTGGCAGGGG
HKR379279 RBd48D07 pGCAP10 NM_002611.3  
GGAGGAGGCGGCCGAACCGCGTCGCTGGGCCGAAAGGTGCGCGAGCGCTGCCCGCGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl