Prev. |  KEGG KO K13756 > 

RIKEN DNA Bank Human Resource - PDE6B

Gene ID NCBI Gene 5158 |  KEGG hsa:5158
Gene Symbol PDE6B
Protein Name phosphodiesterase 6B
Synonyms CSNB3|CSNBAD2|GMP-PDEbeta|PDEB|RP40|rd1
Ortholog resources KEGG ortholog (KEGG orthology K13756) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030972 IRAK077H04 pBluescriptR BC039412 NM_000283
HGY082550 IRAL006G06 pOTB7 BC000249 NM_000283 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081206 M01C003A06 pDONR221 04-134-2_2-B03 BC000249 NM_000283  
HGE081254 M01C003C06 pDONR221 04-134-2_2-B03 BC000249 NM_000283  
HGE081302 M01C003E06 pDONR221 04-134-2_2-B03 BC000249 NM_000283  
HGE081350 M01C003G06 pDONR221 04-134-2_2-B03 BC000249 NM_000283  
HGE081398 M01C003I06 pDONR221 04-134-2_2-B03 BC000249 NM_000283  
HGE081446 M01C003K06 pDONR221 04-134-2_2-B03 BC000249 NM_000283  
HGE081494 M01C003M06 pDONR221 04-134-2_2-B03 BC000249 NM_000283  
HGE081542 M01C003O06 pDONR221 04-134-2_2-B03 BC000249 NM_000283  
HGE097202 M01C043A02 pDONR221 MGC11-B01 BC000249 NM_000283  
HGE097250 M01C043C02 pDONR221 MGC11-B01 BC000249 NM_000283  
HGE097298 M01C043E02 pDONR221 MGC11-B01 BC000249 NM_000283  
HGE097346 M01C043G02 pDONR221 MGC11-B01 BC000249 NM_000283  
HGE097394 M01C043I02 pDONR221 MGC11-B01 BC000249 NM_000283  
HGE097442 M01C043K02 pDONR221 MGC11-B01 BC000249 NM_000283  
HGE097490 M01C043M02 pDONR221 MGC11-B01 BC000249 NM_000283  
HGE097538 M01C043O02 pDONR221 MGC11-B01 BC000249 NM_000283  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_210404.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE016588 W01A041H20 pENTR-TOPO IRAL006G06 BC000249 NM_000283  
HGE016590 W01A041H22 pENTR-TOPO IRAL006G06 BC000249 NM_000283  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR361606 RBd04A06 pGCAP10 NM_000283.3  
GAGTGAGGAGCAGGCCCGGAGCTTTCTGGACCAGAACCCCGATTTTGCCCGCCAGTACTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl