Prev. |  KEGG KO K18437 > 

RIKEN DNA Bank Human Resource - PDE8A

Gene ID NCBI Gene 5151 |  KEGG hsa:5151
Gene Symbol PDE8A
Protein Name phosphodiesterase 8A
Synonyms HsT19550
Ortholog resource in our bank

  PDE8A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006334 IRAK015N22 pCMV-SPORT6 BC017164 NM_173457 Partial
HGX037274 IRAK093D02 pCMV-SPORT6 BC048317 NM_173457 Partial
HGY053352 IRAK133G08 pBluescript BC060762 NM_173457 Full
HGY103487 IRAL058L23 pOTB7 BC075822 NM_173457 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209561 ARiS023P01 pGCAP10 NM_002605.2  
GGCGCTTCTCGACGGTGCGGCCCCAGGCCCCGCTGGAGCCGAGCTGCTCCCCTCCCTACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl