Prev. |  KEGG KO K08718 > 

RIKEN DNA Bank Human Resource - PDE6A

Gene ID NCBI Gene 5145 |  KEGG hsa:5145
Gene Symbol PDE6A
Protein Name phosphodiesterase 6A
Synonyms CGPR-A|PDEA|RP43
Ortholog resources KEGG ortholog (KEGG orthology K08718) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR405561 RBdS013P01 pGCAP10 NM_000440.2 done
GAGTATGTTTTGCAGACAAGACCCAGAGAAGTCCAGACTGGACTTGTTGCAGACTGCAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl