RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - PDE6A

Gene ID	NCBI Gene 5145 \| KEGG hsa:5145
Gene Symbol	PDE6A
Protein Name	phosphodiesterase 6A
Synonyms	CGPR-A\|PDEA\|RP43

Ortholog resource in our bank

  PDE6A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR405561	RBdS013P01	pGCAP10	NM_001410788.1	full cds
HKR405561	GAGTATGTTTTGCAGACAAGACCCAGAGAAGTCCAGACTGGACTTGTTGCAGACTGCAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl