Prev. |  KEGG KO K13296 > 

RIKEN DNA Bank Human Resource - PDE3B

Gene ID NCBI Gene 5140 |  KEGG hsa:5140
Gene Symbol PDE3B
Protein Name phosphodiesterase 3B
Synonyms HcGIP1|cGIPDE1
Ortholog resources KEGG ortholog (KEGG orthology K13296) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172436 ARi31B12 pGCAP10 NM_000922.2  
AAAGTGGAGCTGCGGCCGCCGCCGGCCTCTCCCCAGCAGCCGCGGCGCTGCTCCCCCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl