Prev. |  KEGG KO K15595 > 

RIKEN DNA Bank Human Resource - CDK17

Gene ID NCBI Gene 5128 |  KEGG hsa:5128
Gene Symbol CDK17
Protein Name cyclin dependent kinase 17
Synonyms PCTAIRE2|PCTK2
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  CDK17

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013395 IRAK033I03 pBluescriptR BC033005 NM_002595 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE027834 W01A069J18 pENTR-TOPO IRAK033I03 BC033005 NM_002595  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR335374 RBb38H06 pGCAP1 NM_002595.2  
GGGGTAAGCTCCCGCGGCCGGTCGCTTTTCTCCGCCGCCGCTGGTTGGATCGTTTCAATA
HKR346948 RBb67G04 pGCAP1 NM_002595.2  
GTCCCGCGGCCGGTCGCTTTTCTCCGCCGCCGCTGGTTGGATCGTTTCAATAAAAGTGTT
HKR399204 RBd98A04 pGCAP10 NM_002595.2  
GGCGGAGGCGTCAATCCGCAGCCGCCGAGTGTGAAAGCGACGCACACGCAAGGAGCGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl