Prev. |  KEGG KO K00573 > 

RIKEN DNA Bank Human Resource - PCMT1

Gene ID NCBI Gene 5110 |  KEGG hsa:5110
Gene Symbol PCMT1
Protein Name protein-L-isoaspartate (D-aspartate) O-methyltransferase
Synonyms PIMT
Ortholog resources KEGG ortholog (KEGG orthology K00573) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082254 IRAL005K14 pOTB7 BC008748 NM_005389 Full/var
HGY084354 IRAL010O18 pOTB7 BC007501 NM_005389 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR073323 ARe83F03 pKA1U5 NM_005389.1  
GGCAGTGGCGGCAGCGGCGGCGACGGCAGTAACAGCTTGCAGCTACAGCGGGGACGCGAG
HKR279370 ARiS198H02 pGCAP10 NM_005389.1  
GGCAGTGGCGGCAGCGGCGGCGACGGCAGTAACAGCGGCAGCTACAGCGGGGACGCGAGC
HKR322053 RBb05C05 pKA1U5 NM_005389.1  
GGGCGACGGCAGTAACAGCGGCAGCTACAGCGGGGACGCGAGCGGGGCGGTGACGGTGTG
HKR327676 RBb19D04 pKA1U5 NM_005389.1  
GGGCGGCAGCGGCGGCGACGGCAGTAACAGCGGCAGCTACAGCGGGGACGCGAGCGGGGC
HKR342500 RBb56E04 pGCAP1 NM_005389.1  
TTGGGCCGGGAGCGCGCAGTGGCGGCAGCGGCGGCGACGGCAGTAACAGCGGCAGCTACA
HKR347775 RBb69H07 pGCAP1 NM_005389.1  
GGACGGCAGTAACAGCGGCAGCTACAGCGGGGACGCGAGCGGGGCGGTGACGGTGTGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl