Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PCK2

Gene ID (NCBI) 5106
Gene Symbol PCK2
Protein Name phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Synonyms PEPCK|PEPCK-M|PEPCK2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081769 IRAL004H01 pOTB7 BC001454 NM_004563 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR386902 RBd67E06 pGCAP10 NM_004563.2  
GGTGGCTCGCTTCGCCGCGCTCCCTCCTTCCCCGCCTTCCATACCTCCCCGGCTCCGCTC
HKR406104 RBdS015E08 pGCAP10 NM_004563.2  
GGTGGCTCGCTTCGCCGCGCTCCCTCCTTCCCCGCCTTCCATACCTCCCCGGCTCCGCTC
HKR442382 RBdS105P22 pGCAP10 NM_004563.2  
GATACCTCCCCGGCTCCGCTCGGTTCCTGGCCACCCCGCAGCCCCTGCCCAGGTGCCATG
HKR444166 RBdS110G22 pGCAP10 NM_004563.2  
GGTGGCTCGCTTCGCCGCGCTCCCTCCTTCCCCGCCTTCCATACCTCCCCGGCTCCGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl