Prev. |  KEGG KO K01724 > 

RIKEN DNA Bank Human Resource - PCBD1

Gene ID NCBI Gene 5092 |  KEGG hsa:5092
Gene Symbol PCBD1
Protein Name pterin-4 alpha-carbinolamine dehydratase 1
Synonyms DCOH|PCBD|PCD|PHS
Ortholog resources KEGG ortholog (KEGG orthology K01724) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087053 IRAL017K13 pOTB7 BC006324 NM_000281 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024499 W01A061E03 pENTR-TOPO IRAL017K13 BC006324 NM_000281  
HGE024501 W01A061E05 pENTR-TOPO IRAL017K13 BC006324 NM_000281  
HGE024503 W01A061E07 pENTR-TOPO IRAL017K13 BC006324 NM_000281  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171750 ARi29G06 pGCAP10 NM_000281.2  
GGGCCACCTGCTGCCGCCCGCGCCATGGCTGGCAAAGCACACAGGCTGAGCGCTGAGGAG
HKR174474 ARi36D02 pGCAP10 NM_000281.2  
GGGCCACCTGCTGCCGCCCGCGCCATGGCTGGCAAAGCACACAGGCTGAGCGCTGAGGAG
HKR203474 ARiS008L10 pGCAP10 NM_000281.2  
GGCTGGCCACCTGCTGCCGCCCGCGCCATGGCTGGCAAAGCACACAGGCTGAGCGCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl