Prev. | 

RIKEN DNA Bank Human Resource - PEBP1

Gene ID NCBI Gene 5037 |  KEGG hsa:5037
Gene Symbol PEBP1
Protein Name phosphatidylethanolamine binding protein 1
Synonyms HCNP|HCNPpp|HEL-210|HEL-S-34|HEL-S-96|PBP|PEBP|PEBP-1|RKIP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019539 IRAK048O03 pBluescriptR BC031102 NM_002567 Full
HGY080610 IRAL001I18 pOTB7 BC008714 NM_002567 Full
HGY093109 IRAL032M21 pDNR-LIB BC017396 NM_002567 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040477 ARe01D05 pKA1U5 NM_002567.2  
GGTGGTCGCTGGGTCTGCGTCTTCCCGAGCCAGTGTGCTGAGCTCTCCGCGTCGCCTCTG
HKR052950 ARe32G06 pKA1U5 NM_002567.2  
GGGTCTGCGTCTTCCCGAGCCAGTGTGNTGAGCTCTTNCGCGATCGCCTCTGGTCGCCCG
HKR064524 ARe61F04 pKA1U5 NM_002567.2  
GGCGTGGTCGCTGGGTCTGCGTCTTCCCGAGCCNNTTTGNTGAGCTCTCCGCGTCGCCTC
HKR076003 ARe90A03 pKA1U5 NM_002567.2  
GAGTGTGCTGAGCTCTCCGCGTCGCCTCTGTCGCCCGCGCCTGGCCTACCGCGGCACTCC
HKR178429 ARi46B05 pGCAP10 NM_002567.2  
GACTCCCGGCTGCACGCTCTGCTTGGCCTCGCCATGCCGGTGGACCTCAGCAAGTGGTCC
HKR182856 ARi57C08 pGCAP10 NM_002567.2  
GGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCCTCGCCATGCCGGT
HKR183327 ARi58F07 pGCAP10 NM_002567.2  
GGTCTGCGTCTTCCCGAGCCAGTGTGCTGAGCTCTCCGCGTCGCCTCTGTCGCCCGCGCC
HKR243638 ARiS109B14 pGCAP10 NM_002567.2  
GGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCCTCGCCATGCCGGT
HKR260362 ARiS150P02 pGCAP10 NM_002567.2  
TGAGTGTGCTGAGCTCTCCGCGTCGCCTCTGTCGCCCGCGCCTGGCCTACCGCGGCACTC
HKR264458 ARiS161C10 pGCAP10 NM_002567.2  
GGGGGAGTCNNCGTCTTCCCCAGCCCTTNNGATGAGATGNCGGGGCTCGNNCCCNTGCCN
HKR329346 RBb23G02 pGCAP1 NM_002567.2  
GGCTCTCCGCGTCGCCTCTGTCGCCCGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACG
HKR330403 RBb26A03 pGCAP1 NM_002567.2  
GGAGGCGCGTGCTCTCGCGTGGTCGCTGGGTCTGCGTCTTCCCGAGCCAGTGTGCTGAGC
HKR331377 RBb28H09 pGCAP1 NM_002567.2  
GCCTTTGTCGCCCGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCCT
HKR335307 RBb38E11 pGCAP1 NM_002567.2  
TTGCGTCTTCCCGAGCCAGTGTGCTGAGCTCTCCGCGTCGCCTTTGTCGCCCGCGCCTGG
HKR344952 RBb62G08 pGCAP1 NM_002567.2  
HKR364832 RBd12B08 pGCAP10 NM_002567.2  
GTTTCCCGAGCCAGTGTGCTGAGCTCTCCGCGTCGCCTCTGTCGCCCGCGCCTGGCCTAC
HKR365230 RBd13B06 pGCAP10 NM_002567.2  
GGGGTCTGCGTCTTCCCGAGCCAGTGTGCTGAGCTCTCCGCGTCGCCTCTGTCGCCCGCG
HKR366056 RBd15C08 pGCAP10 NM_002567.2  
GGCCTCTGTCGCCCGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCC
HKR372549 RBd31G05 pGCAP10 NM_002567.2  
GGTGTGCTGAGCTCTCCGCGTCGCCTCTGTCGCCCGCGCCTGGCCTACCGCGGCACTCCC
HKR378923 RBd47F03 pGCAP10 NM_002567.2  
GGGTGCGCGGGGCTGGGCGGCGGCTGAGGCGCGTGCTCTCGCGTGGTCGCTGGGTCTGCG
HKR378926 RBd47F06 pGCAP10 NM_002567.2  
GGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCCTCGCCATGCCGGT
HKR384012 RBd60A12 pGCAP10 NM_002567.2  
GCTGCGTCTTCCCGAGCCAGTGTGCTGAGCTCTCCGCGTCGCCTCTGTCGCCCGCGCCTG
HKR391225 RBd78B01 pGCAP10 NM_002567.2  
GGGGTCTGCGTCTTCCCGAGCCAGTGTGCTGAGCTCTCCGCGTCGCCTCTGTCGCCCGCG
HKR398531 RBd96F11 pGCAP10 NM_002567.2  
GGTCTTCCCGAGCCAGTGTGCTGAGCTCTCCGCGTCGCCTTTGTCGCCCGCGCCTGGCCT
HKR405477 RBdS013L13 pGCAP10 NM_002567.2  
GGGCACTCCCGGCTGCACGCTCTGCTTGGCCTCGCCATGCCGGTGGACCTCAGCAAGTGG
HKR406261 RBdS015K21 pGCAP10 NM_002567.2  
GGCCTTTGTCGCCCGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCC
HKR408946 RBdS022G02 pGCAP10 NM_002567.2  
GGCCTTTGTCGCCCGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCC
HKR442230 RBdS105J14 pGCAP10 NM_002567.2  
GGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCCTCGCCATGCCGGT
HKR444295 RBdS110M07 pGCAP10 NM_002567.2  
GAGTGTGCTGAGCTCTCCGCGTCGCCTCTGTCGCCCGCGCCTGGCCTACCGCGGCACTCC
HKR453095 RBdS132M07 pGCAP10 NM_002567.2  
GGCCTTTGTCGCCCGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCC
HKR474926 RBdS187F06 pGCAP10 NM_002567.2  
GGTCGCCCGCGCCTGGCCTACCGCGGCACTCCCGGCTGCACGCTCTGCTTGGCCTCGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl