Prev. |  KEGG KO K04229 > 

RIKEN DNA Bank Human Resource - OXTR

Gene ID NCBI Gene 5021 |  KEGG hsa:5021
Gene Symbol OXTR
Protein Name oxytocin receptor
Synonyms OT-R
Ortholog resources KEGG ortholog (KEGG orthology K04229) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065356 ARe63G12 pKA1U5 NM_000916.3  
GAGGCTCTGGGACCAACGCTGGGCGAACCAGCTCCTCTCCGGAGGGGTCTGCGCGGCTGG
HKR079722 ARe99F02 pKA1U5 NM_000916.3  
GGTACCCATCCAGCGTACCAGCCAGGCTGCGGCGAGNGGATTCCAACCGAGGCTCCAGTG
HKR168884 ARi22D12 pGCAP10 NM_000916.3  
TGGCCGTCCGCGCGCGCAGCCTGGGAGGCGCTCCTCGCTCGCCTCCTGTACCCATCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl