Prev. |  KEGG KO K02604 > 

RIKEN DNA Bank Human Resource - ORC2

Gene ID NCBI Gene 4999 |  KEGG hsa:4999
Gene Symbol ORC2
Protein Name origin recognition complex subunit 2
Synonyms ORC2L
Ortholog resources KEGG ortholog (KEGG orthology K02604) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001207 IRAK003A07 pCMV-SPORT6 BC014834 NM_006190 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE042318 W01A105N06 pENTR-TOPO IRAK003A07 BC014834 NM_006190  
HGE042322 W01A105N10 pENTR-TOPO IRAK003A07 BC014834 NM_006190  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR406204 RBdS015I12 pGCAP10 NM_006190.3  
GGGGAGATTCGGTGTGCCGCACGCAGGCTTCCCATCCCCCAGCTGGCCTCCGGTGCTCCT
HKR475041 RBdS187K01 pGCAP10 NM_006190.3  
GAGCTGGCCTCCGGTGCTCCTTACCTCCCCGGTGGTCGGGCGCGAATTACTGGAAATTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl