Prev. |  KEGG KO K16613 > 

RIKEN DNA Bank Human Resource - OAZ2

Gene ID NCBI Gene 4947 |  KEGG hsa:4947
Gene Symbol OAZ2
Protein Name ornithine decarboxylase antizyme 2
Synonyms AZ2
Ortholog resources KEGG ortholog (KEGG orthology K16613) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054100 ARe35E04 pKA1U5 NM_002537.2  
GAGTTGGAGGCAGGCGCTCGCTGAGGCAAAAGGAGGCGCTCGGCCCGCGGCCTGACAGGG
HKR069747 ARe74G03 pKA1U5 NM_002537.2  
GAGGCGCTCGCTGAGGCAAAAGGAGGCGCTCGGCCCGCGGCCTGACAGGGACTTAGCCCG
HKR178956 ARi47G12 pGCAP10 NM_002537.2  
GAGTTGGAGGCAGGCGCTCGCTGAGGCAAAAGGAGGCGCTCGGCCCGCGGCCTGACAGGG
HKR182474 ARi56D02 pGCAP10 NM_002537.2  
GAGTTGGAGGCAGGCGCTCGCTGAGGCAAAAGGAGGCGCTCGGCCCGCGGCCTGACAGGG
HKR188177 ARi70H09 pGCAP10 NM_002537.2  
GAGTTGGAGGCAGGCGCTCGCTGAGGCAAAAGGAGGCGCTCGGCCCGCGGCCTGACAGGG
HKR234889 ARiS087D17 pGCAP10 NM_002537.2  
GAGTNGGAGGCAGGCGCTCNCTGAGGCAAAAGGAGGCGCTCGGCCCGCGGCCTGACAGGG
HKR348029 RBb70B05 pGCAP1 NM_002537.2  
AGTTGGAGGCAGGCGCTCGCTGAGGCAAAAGGAGGCGCTCGGCCCGCGGCCTGACAGGGA
HKR364460 RBd11C12 pGCAP10 NM_002537.2  
GAGTTGGAGGCAGGCGCTCGCTGAGGCAAAAGGAGGCGCTCGGCCCGCGGCCTGACAGGG
HKR375255 RBd38C07 pGCAP10 NM_002537.2  
GGCAGGCGCTCGCTGAGGCAAAAGGAGGCGCTCGGCCCGCGGCCTGACAGGGACTTAGCC
HKR416054 RBdS040C06 pGCAP10 NM_002537.2  
GGGCGGCCGGGGAGGGTCAGTTGGAGGCAGGCGCTCGCTGAGGCAAAAGGAGGCGCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl