Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NTN3

Gene ID (NCBI) 4917
Gene Symbol NTN3
Protein Name netrin 3
Synonyms NTN2L
Databases KEGG hsa:4917 |  NCBI Gene 4917
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06844)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR416366 RBdS040P06 pGCAP10 NM_006181.1  
GGAGGCCGGGAGACCTGCTCCGCCCGGCCCTCGCCTGCGACTGTCACCCGGTTGGTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl