Prev. |  KEGG KO K21398 > 

RIKEN DNA Bank Human Resource - SLC11A2

Gene ID NCBI Gene 4891 |  KEGG hsa:4891
Gene Symbol SLC11A2
Protein Name solute carrier family 11 member 2
Synonyms AHMIO1|DCT1|DMT1|NRAMP2
Featured content Lysosome (human)
Ortholog resource in our bank

  SLC11A2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081784 IRAL004H16 pOTB7 BC002592 NM_000617 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015921 W01A039N09 pENTR-TOPO IRAL004H16 BC002592 NM_000617  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070930 ARe77F10 pKA1U5 NM_000617.2  
GGCGGGGCAGGGGAGGGCGTTAGCCAGCATTGGCCCTTTNNTCCCGGAATATGGAGCCCT
HKR235343 ARiS088F23 pGCAP10 NM_000617.2  
TAGCTTGGCGCTGGCTCCCGGAATATGGAGCCCTGGGCGCGGGGGCGGCGTGTCAGGTGG
HKR403149 RBdS007O13 pGCAP10 NM_000617.2  
TGGGGCGCGGGGGCGGCGTGTCAGGTGGTTGCGGAGCTGGTAAGAATCATATTCTAAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.07.20

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl