Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NPPC

Gene ID (NCBI) 4880
Gene Symbol NPPC
Protein Name natriuretic peptide C
Synonyms CNP|CNP2
Databases KEGG hsa:4880 |  NCBI Gene 4880
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12336)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR379658 RBd49C10 pGCAP10 NM_024409.1  
TGAGAGCGCACCCAGCCGGCGCCGCGCAGCACTGGGACCCTGCTCGCCCTGCAGCCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl