Prev. |  KEGG KO K12336 > 

RIKEN DNA Bank Human Resource - NPPC

Gene ID NCBI Gene 4880 |  KEGG hsa:4880
Gene Symbol NPPC
Protein Name natriuretic peptide C
Synonyms CNP|CNP2
Ortholog resource in our bank

  NPPC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR379658 RBd49C10 pGCAP10 NM_024409.4 Full done
TGAGAGCGCACCCAGCCGGCGCCGCGCAGCACTGGGACCCTGCTCGCCCTGCAGCCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl