Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NPPB

Gene ID (NCBI) 4879
Gene Symbol NPPB
Protein Name natriuretic peptide B
Synonyms BNP
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX019975 IRAK049P15 pCMV-SPORT6 BC025785 NM_002521 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE027257 W01A068C09 pENTR-TOPO IRAK049P15 BC025785 NM_002521
HGE033891 W01A084M03 pENTR-TOPO IRAK049P15 BC025785 NM_002521
HGE033893 W01A084M05 pENTR-TOPO IRAK049P15 BC025785 NM_002521
HGE033897 W01A084M09 pENTR-TOPO IRAK049P15 BC025785 NM_002521
HGE033907 W01A084M19 pENTR-TOPO IRAK049P15 BC025785 NM_002521
HGE033909 W01A084M21 pENTR-TOPO IRAK049P15 BC025785 NM_002521
HGE033911 W01A084M23 pENTR-TOPO IRAK049P15 BC025785 NM_002521

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR041748 ARe04G04 pKA1U5 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR081656 ARf04C08 pKA1U5 NM_002521.2
ATGAGGACNACCCTGGTGACAGCTNGANNTGAAGAGGCGAATNNAAGCCNTNCNCGTCCC
HKR082027 ARf05B03 pKA1U5 NM_002521.2
TGAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGC
HKR162127 ARi05F07 pGCAP10 NM_002521.2
GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
HKR163325 ARi08F05 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR046948 ARe17G04 pKA1U5 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR164480 ARi11D08 pGCAP10 NM_002521.2
GTCTGGCTGCTTTGGGAGGAAGATGGACCGGATCAGCTCCTCCAGTGGCCTGGGCTGCAA
HKR167250 ARi18C02 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR053348 ARe33G04 pKA1U5 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR174057 ARi35C09 pGCAP10 NM_002521.2
GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
HKR056453 ARe41C05 pKA1U5 NM_002521.2
GAGGCCCGACACTCAGCTCCAGGATAAAAGGCCACGGTTGNTCCCGAGGAGCCAGGAGGA
HKR176178 ARi40H10 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR178036 ARi45B12 pGCAP10 NM_002521.2
GAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
HKR178125 ARi45F05 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR063723 ARe59F03 pKA1U5 NM_002521.2
TGAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGC
HKR182501 ARi56E05 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR183635 ARi59B11 pGCAP10 NM_002521.2
GAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
HKR065660 ARe64C12 pKA1U5 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGCTGGGAAGCAAACCCGGACGCATCGCAGC
HKR066130 ARe65F10 pKA1U5 NM_002521.2
GATGAGCACCCCGTCAGGCGTGAGGGCAGGGTGGNAANNAAACCCGGTACGCATCGCAAC
HKR187774 ARi69H06 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR068097 ARe70E01 pKA1U5 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGCNATNAAAACCCGGACGCATCGCAGCA
HKR188026 ARi70B02 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR188169 ARi70H01 pGCAP10 NM_002521.2
GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
HKR072054 ARe80C06 pKA1U5 NM_002521.2
AGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAG
HKR072177 ARe80H09 pKA1U5 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR078976 ARe97H08 pKA1U5 NM_002521.2
ATCCTGGAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATC
HKR203350 ARiS008G06 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR208150 ARiS020G06 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR222089 ARiS055D17 pGCAP10 NM_002521.2
GAGGAGGANCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACNCATCNCANCA
HKR222097 ARiS055E01 pGCAP10 NM_002521.2
GAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
HKR234818 ARiS087A18 pGCAP10 NM_002521.2
GNGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
HKR235099 ARiS087M11 pGCAP10 NM_002521.2
GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
HKR235325 ARiS088F05 pGCAP10 NM_002521.2
GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
HKR238626 ARiS096J10 pGCAP10 NM_002521.2
GAGGAGGNNCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR247576 ARiS118P16 pGCAP10 NM_002521.2
GAGGAGCTNCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
HKR277882 ARiS194L18 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR277980 ARiS194P20 pGCAP10 NM_002521.2
GAGGANNANCNCCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
HKR279233 ARiS198B09 pGCAP10 NM_002521.2
HKR279276 ARiS198D04 pGCAP10 NM_002521.2
GAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
HKR279425 ARiS198J09 pGCAP10 NM_002521.2
GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl