RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - NPC1

Gene ID	NCBI Gene 4864 \| KEGG hsa:4864
Gene Symbol	NPC1
Protein Name	NPC intracellular cholesterol transporter 1
Synonyms	NPC\|POGZ\|SLC65A1
Featured content	Lysosome (human)

Ortholog resource in our bank

  NPC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR168880	ARi22D08	pGCAP10	NM_000271.3
HKR168880	GGGGGTGCTGAAACAGCCCGGGGAAGTAGAGCCGCCTCCGGGGAGCCCAACCAGCCGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl