Prev. |  KEGG KO K10643 > 

RIKEN DNA Bank Human Resource - CNOT4

Gene ID NCBI Gene 4850 |  KEGG hsa:4850
Gene Symbol CNOT4
Protein Name CCR4-NOT transcription complex subunit 4
Synonyms CLONE243|NOT4|NOT4H
Ortholog resources KEGG ortholog (KEGG orthology K10643) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027916 IRAK069N04 pCMV-SPORT6 BC035590 NM_001008225 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053332 ARe33F12 pKA1U5 NM_013316.2  
GGAGGCCGGAGGAGTCTTACCCTAATGTAAGATGGTGGCCCGTCTGGCTGTGGAACCCAC
HKR184810 ARi62A10 pGCAP10 NM_013316.2  
GGCCGGATCAGCGTGCGCCTGCGCACGGGAGGCCGGAGGAGTCTTACCCTAATGTAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl