Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NONO

Gene ID (NCBI) 4841
Gene Symbol NONO
Protein Name non-POU domain containing, octamer-binding
Synonyms NMT55|NRB54|P54|P54NRB
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX020924 IRAK052F04 pCMV-SPORT6 BC028299 NM_007363 Full
HGY080756 IRAL001O20 pOTB7 BC002364 NM_007363 Full
HGY083644 IRAL009B20 pOTB7 BC003129 NM_007363 Full
HGY085789 IRAL014H21 pOTB7 BC004113 NM_007363 Partial
HGY090997 IRAL027I05 pOTB7 BC010049 NM_007363 Partial/var
HGY091873 IRAL029L09 pOTB7 BC012141 NM_007363 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR082857 ARf07C09 pKA1U5 NM_007363.3
GGTTTCCGGCGGTCGCGCGCTCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTT
HKR164132 ARi10F12 pGCAP10 NM_007363.3
GCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTTACTCCGAGGAGATACCAGTC
HKR067279 ARe68D07 pKA1U5 NM_007363.3
ATCCTGTTTTTTCTCGGGACGGGAGAGGCCGTGCTAGCGTCGCCGTTACTCCGAGGAGAT
HKR185226 ARi63B02 pGCAP10 NM_007363.3
GGTTTCCGGCGGTCGCGCGCTCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTT
HKR078876 ARe97D04 pKA1U5 NM_007363.3
GCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTTACTCCGAGGAGATACCAGTC
HKR366476 RBd16D04 pGCAP10 NM_007363.3
GGGTCGCGCGCTCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTTACTCCGAGG
HKR368525 RBd21F05 pGCAP10 NM_007363.3
CCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTTACTCCGAGGAGATACCAGTC
HKR385657 RBd64C09 pGCAP10 NM_007363.3
GACCGAGCTCCGTCGTCTCGTTTCCGGCGGTCGCGCGCTCTTTTCTCGGGACGGGAGAGG
HKR387326 RBd68F06 pGCAP10 NM_007363.3
TGTNCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTTACTCCGAGGAGATACCA
HKR389351 RBd73G07 pGCAP10 NM_007363.3
GGGTCCCNNGCTCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTTACTCCGAGG
HKR394826 RBd87B02 pGCAP10 NM_007363.3
GGTTTCCGGCGGTCGCGCGCTCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl