Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NME1

Gene ID (NCBI) 4830
Gene Symbol NME1
Protein Name NME/NM23 nucleoside diphosphate kinase 1
Synonyms AWD|GAAD|NB|NBS|NDKA|NDPK-A|NDPKA|NM23|NM23-H1
Databases KEGG hsa:4830 |  NCBI Gene 4830
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00940)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07326 pGL4-phNME1 Promoter collection, Human NME1 promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080413 IRAL001A13 pOTB7 BC000293 NM_000269 Full
HGY091434 IRAL028J18 pOTB7 BC018994 NM_000269 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043206 ARe08A06 pKA1U5 NM_000269.2  
TTGGAACCACGCTGGGTCCCGGGCGCGTTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCA
HKR076076 ARe90D04 pKA1U5 NM_000269.2  
GGAACCACGNTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAAC
HKR180522 ARi51F02 pGCAP10 NM_000269.2  
GGCAGAAGCGTTCCGTGCGTGCAAGTGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGG
HKR320549 RBb01G05 pKA1U5 NM_000269.2  
GGCGTTCCGTGCGCTGCAAGTGCTGCGAACCACGCTGTTGTCCCGGGCGCGTTTTCGGGT
HKR322178 RBb05H10 pKA1U5 NM_000269.2  
GGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAANCAGCTGGAAGGAACCATGGCCAA
HKR325657 RBb14C09 pKA1U5 NM_000269.2  
GAGAAGCGTTCCGTGCGTGCAAGTGCTGCGAACCACGTTGGGTCCCGGGCGCGTTTCGGG
HKR328004 RBb20A04 pKA1U5 NM_000269.2  
ACCACGNTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTA
HKR330001 RBb25A01 pGCAP1 NM_000269.2  
GGTTCAAACCTAAGCAGCTGGAAGGGCCCTGNTGGCTAGGTACCATAGAGTCTCTACACA
HKR332006 RBb30A06 pGCAP1 NM_000269.2  
TCCGTGCGTGCAAGTGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGC
HKR333748 RBb34G04 pGCAP1 NM_000269.2  
AAATGTGGCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAAGCA
HKR334834 RBb37B10 pGCAP1 NM_000269.2  
GAAGTGCTGCGAACCACGNTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGG
HKR336130 RBb40F10 pGCAP1 NM_000269.2  
GCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAAGCAGCTGGAAGGAACCAT
HKR336571 RBb41H03 pGCAP1 NM_000269.2  
GCCCGGGCGCGTTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAAGCAGCTGGA
HKR338081 RBb45D09 pGCAP1 NM_000269.2  
GAAGTGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGA
HKR341231 RBb53B07 pGCAP1 NM_000269.2  
GCGTTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAAGCAGCTGGAAGGAACCA
HKR342077 RBb55D05 pGCAP1 NM_000269.2  
TGGGCAAGTGCTGCGAACCACGTGGGTCCCGGGCGCGATTTCGGGTGCTGGCGGCTGCAG
HKR342970 RBb57H02 pGCAP1 NM_000269.2  
AAATGTGAGTTCAAACCTAAGCAGCTGGAAGGAACCATGGCCAACTGNTGAGCGTACCTT
HKR344545 RBb61G01 pGCAP1 NM_000269.2  
TGGGTTCCGTGCGTGCAAGTGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTG
HKR344970 RBb62H02 pGCAP1 NM_000269.2  
HKR362130 RBd05F10 pGCAP10 NM_000269.2  
GCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAAGCAGCTGGAAGGAACCAT
HKR365635 RBd14B11 pGCAP10 NM_000269.2  
GGTGCGTGCAAGTGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTG
HKR376576 RBd41H08 pGCAP10 NM_000269.2  
GGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTC
HKR392401 RBd81A01 pGCAP10 NM_000269.2  
GGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTC
HKR397725 RBd94F05 pGCAP10 NM_000269.2  
GGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAAGCAGCTGGAAGGAACCATGGCCAA
HKR402897 RBdS007E01 pGCAP10 NM_000269.2  
GAAGTGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGA
HKR430309 RBdS075M21 pGCAP10 NM_000269.2  
GACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAAGC
HKR441850 RBdS104K10 pGCAP10 NM_000269.2  
GGTGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACCTAAGCAGCTGGAAGGAACCATGGCC
HKR441957 RBdS104O21 pGCAP10 NM_000269.2  
GGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTCAAACC
HKR461642 RBdS154B18 pGCAP10 NM_000269.2  
GGTGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl