Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NINJ1

Gene ID (NCBI) 4814
Gene Symbol NINJ1
Protein Name ninjurin 1
Synonyms NIN1|NINJURIN
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080449 IRAL001C01 pOTB7 BC000298 NM_004148 Full/var
HGY083615 IRAL009A15 pOTB7 BC004440 NM_004148 Full/var
HGY087362 IRAL018G18 pOTB7 BC019336 NM_004148 Full/var
HGY097918 IRAL044N06 pOTB7 BC048212 NM_004148

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE004264 W01A010K24 pENTR-TOPO IRAL009A15 BC004440 NM_004148

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR051229 ARe28B05 pKA1U5 NM_004148.3
TTTGGGCAGCTGGAGCCTGCGGCTGAGGCTCGGGCGCGCTCAGGCCCGGATCCTGGCGGC
HKR171660 ARi29C12 pGCAP10 NM_004148.3
GAGGCCCGGATCCTGGCGGCCTGGGCGGCCGCACCATGGACTCGGGAACCGAGGAGTACG
HKR172829 ARi32B05 pGCAP10 NM_004148.3
GAGGCCCGGATCCTGGCGGCCTGGGCGGCCGCACCATGGACTCGGGAACCGAGGAGTACG
HKR074174 ARe85H06 pKA1U5 NM_004148.3
GGGGCGCGCTCAGGCCCGGATCCTGGCGGCCTGGGCGGCCGCACCATGGACTCGGGAACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl