Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NGF

Gene ID (NCBI) 4803
Gene Symbol NGF
Protein Name nerve growth factor
Synonyms Beta-NGF|HSAN5|NGFB
Databases KEGG hsa:4803 |  NCBI Gene 4803
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02582)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027713 IRAK069E17 pCMV-SPORT6 BC032517 NM_002506 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE031847 W01A079K07 pENTR-TOPO IRAK069E17 BC032517 NM_002506  
HGE031849 W01A079K09 pENTR-TOPO IRAK069E17 BC032517 NM_002506  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048431 ARe21B07 pKA1U5 NM_002506.2  
GGGAGGAGCGGAACGGGGCGCGCTAGACCTGGGGCAGTTCCCTCAGCGCGTCTCGGAAGG
HKR065300 ARe63E04 pKA1U5 NM_002506.2  
GAGAGAGCGCTGGGAGCCGGAGGGGAGCGCAGCGGTNAGTCAGGCTGCCCCGAGCCGATC
HKR264462 ARiS161C14 pGCAP10 NM_002506.2  
GAGAGAGCGCTGGGAGCCGGAGGGGAGCGCAGCGAGTTTTGGCCAGTGGTCGTGCAGTCC
HKR335678 RBb39D06 pGCAP1 NM_002506.2  
TAGACAGCAGAGAGCGCTGGGAGCCGGAGGGGAGCGCAGCGAGTTTTTGGCCAGTGGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl