Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NFKBIL1

Gene ID (NCBI) 4795
Gene Symbol NFKBIL1
Protein Name NFKB inhibitor like 1
Synonyms IKBL|LST1|NFKBIL
Databases KEGG hsa:4795 |  NCBI Gene 4795
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09256)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR361756 RBd04G12 pGCAP10 NM_005007.2  
GGCCCTTCCCGCCTCCCGTCTCCGAGCTTCTTAAACACAGGCCTTGGGCCTACGGCTCTG
HKR386052 RBd65C04 pGCAP10 NM_005007.2  
GAGCCTGGAGTGTCTCCGCCCTTCCCGCCTCCCGTCTCCGAGCTTCTTAAACACAGGCCT
HKR405499 RBdS013M11 pGCAP10 NM_005007.2  
GCCTTCCCGCCTCCCGTCTCCGAGCTTCTTAAACACAGGCCTTGGGCCTACGGCTCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl