Prev. |  KEGG KO K04469 > 

RIKEN DNA Bank Human Resource - NFKB2

Gene ID NCBI Gene 4791 |  KEGG hsa:4791
Gene Symbol NFKB2
Protein Name nuclear factor kappa B subunit 2
Synonyms CVID10|H2TF1|LYT-10|LYT10|NF-kB2|p100|p49/p100|p52
Featured content NF-kappa B signaling pathway (human)
Ortholog resource in our bank

  NFKB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05930 pAxCALNLhNFKB2 (forward) Shuttle vector to generate rAd harboring human NFKB2 (forward)
RDB05931 pAxCALNLhNFKB2 (reverse) Shuttle vector to generate rAd harboring human NFKB2 (reverse)
RDB07017 pCMFlag_hsNFKB2 Expression vector of human NFKB2.
RDB07478 pGL4-phNFKB2 Promoter collection, Human NFKB2 promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085116 IRAL012N04 pOTB7 BC002844 NM_002502 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076050 ARe90C02 pKA1U5 NM_002502.3  
GCTTTCCTGCCCCTTCCCCGGCCAAGCCCAACTCCGGATCTCGCTCTCCACCGGATCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl