DNA Bank Top |  KEGG KO K05638 > 

RIKEN DNA Bank Human Resource - NFE2L2

Gene ID NCBI Gene 4780 |  KEGG hsa:4780
Gene Symbol NFE2L2
Protein Name NFE2 like bZIP transcription factor 2
Synonyms HEBP1|IMDDHH|NRF2|Nrf-2

Link

Ortholog resource in our bank

  NFE2L2


External database

human NFE2L2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14132 pIDT-SMART(C-TSC)-FLAG-hNRF2(deletion mutant) Expression vector of N-terminal FLAG-tagged human NRF2 (delition mutants), lacking the two transcription activation domains (Neh4-5; 111-201 a.a.)    
RDB14131 pIDT-SMART(C-TSC)-FLAG-hNRF2(WT) Expression vector of N-terminal FLAG-tagged human NRF2 (WT).    
RDB06265 pCMFlag_hsNFE2L2 Expression vector of human NFE2L2.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091618 IRAL029A18 pOTB7 BC011558 NM_006164.5 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002684 W01A006L20 pENTR-TOPO IRAL029A18 BC011558 NM_006164  
HGE002686 W01A006L22 pENTR-TOPO IRAL029A18 BC011558 NM_006164  
HGE002688 W01A006L24 pENTR-TOPO IRAL029A18 BC011558 NM_006164  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048828 ARe22B04 pKA1U5 NM_006164.3  
GACCGAGTGCCGGGGAGCCCGGAGGAGCCGCCGACNCAGCCGCCACCGCCGCCGCCGCCG
HKR171260 ARi28C12 pGCAP10 NM_006164.3  
GGCCCGGAGGAGCCGCCGACGCAGCCGCCACCGCCGCCGCCGCCGCCACCAGAGCCGCCC
HKR372407 RBd31A07 pGCAP10 NM_006164.3  
GACCGAGTGCCGGGGAGCCCGGAGGAGCCGCCGACGCAGCCGCCACCGCCGCCGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl